Encomenda rápida

Text Size:AAA

Rhesus Interferon Gamma/IFN gamma/IFNG clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Myc Etiqueta

Folha de dadosAnálisesProdutos relacionadosProtocolos
Cynomolgus IFNG Informações sobre o produto de clone de cDNA
Gene_bank_ref_id:NM_001032905.1
Tamanho de cDNA:498bp
Descrição de cDNA:Full length Clone DNA of Macaca mulatta (Rhesus monkey) interferon-gamma with N terminal Myc tag.
Sinónimo de gene:IFN-gamma, IFNG
Espécie:Rhesus
Vetor:pCMV3-SP-N-Myc
Plasmid:
Local de restrição:
Sequência de etiqueta:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Descrição da sequência:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Rhesus Interferon Gamma/IFN gamma/IFNG clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Myc Etiqueta on other vectors
Rhesus Interferon Gamma/IFN gamma/IFNG clonagem de ADN ou de clonagem do gene (vector de clonagem), C-GFPSpark EtiquetaCG90008-ACG$225
Rhesus Interferon Gamma/IFN gamma/IFNG clonagem de ADN ou de clonagem do gene (vector de clonagem), C-OFPSpark EtiquetaCG90008-ACR$225
Rhesus Interferon Gamma/IFN gamma/IFNG clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag EtiquetaCG90008-CF$195
Rhesus Interferon Gamma/IFN gamma/IFNG clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His EtiquetaCG90008-CH$195
Rhesus Interferon Gamma/IFN gamma/IFNG clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Myc EtiquetaCG90008-CM$195
Rhesus Interferon Gamma/IFN gamma/IFNG clonagem de ADN ou de clonagem do gene (vector de clonagem), C-HA EtiquetaCG90008-CY$195
Rhesus Interferon Gamma/IFN gamma/IFNG clonagem de ADN ou de clonagem do gene (vector de expressão)CG90008-M$75
Rhesus Interferon Gamma/IFN gamma/IFNG clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Flag EtiquetaCG90008-NF$195
Rhesus Interferon Gamma/IFN gamma/IFNG clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His EtiquetaCG90008-NH$195
Rhesus Interferon Gamma/IFN gamma/IFNG clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Myc EtiquetaCG90008-NM$195
Rhesus Interferon Gamma/IFN gamma/IFNG clonagem de ADN ou de clonagem do gene (vector de clonagem), N-HA EtiquetaCG90008-NY$195
Rhesus Interferon Gamma/IFN gamma/IFNG clonagem de ADN ou de clonagem do gene (vector de clonagem)CG90008-UT$195
 Saiba mais sobre vectores de expressão
Product nameProduct name
Fundo

IFN gamma, also known as IFNG, is a secreted protein which belongs to the type I I interferon family. IFN gamma is produced predominantly by natural killer and natural killer T cells as part of the innate immune response, and by CD4 and CD8 cytotoxic T lymphocyte effector T cells once antigen-specific immunity develops. IFN gamma has antiviral, immunoregulatory, and anti-tumor properties. IFNG, in addition to having antiviral activity, has important immunoregulatory functions, it is a potent activator of macrophages, and has antiproliferative effects on transformed cells and it can potentiate the antiviral and antitumor effects of the type I interferons. The IFNG monomer consists of a core of six α-helices and an extended unfolded sequence in the C-terminal region. IFN gamma is critical for innate and adaptive immunity against viral and intracellular bacterial infections and for tumor control. Aberrant IFN gamma expression is associated with a number of autoinflammatory and autoimmune diseases. The importance of IFN gamma in the immune system stems in part from its ability to inhibit viral replication directly, and most importantly from its immunostimulatory and immunomodulatory effects. IFNG also promotes NK cell activity.

Referências
  • Gray P W, et al. (1982) Structure of the human immune interferon gene. Nature. 298: 859-63.
  • Taya Y, et al. (1982) Cloning and structure of the human immune interferon-gamma chromosomal gene. EMBO J. 1: 953-8.
  • Goshima N, et al. (2008) Human protein factory for converting the transcriptome into an in vitro-expressed proteome. Nomura N Nat Methods. 5: 1011-7.
  • Thiel DJ, et al. (2000) Observation of an unexpected third receptor molecule in the crystal structure of human interferon-gamma receptor complex. Structure. 8 (9): 927-36.
  • Naylor SL, et al. (1983) Human immune interferon gene is located on chromosome 12. J Exp Med. 157 (3): 1020-7.
  • Schoenborn JR, et al. (2007) Regulation of interferon-gamma during innate and adaptive immune responses. Adv Immunol. 96: 41-101.
  • Size / Price
    Catálogo: CG90008-NM
    Preço de catálogo: 
    Preço:      (You Save: )
    Tamanho:
    Quantidade:+-
    Disponibilidade2-3 weeks
    Bulk Discount RequiryAcrescentar a carrinho
    Contact Us
    Imagens
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Tenha em atenção o seguinte: Todos os produtos destinam-se "A FINS EXCLUSIVOS DE INVESTIGAÇÃO E NÃO DEVEM SER UTILIZADOS PARA EFEITOS DE DIAGNÓSTICO OU TERAPÊUTICOS"