After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Encomenda rápida

Text Size:AAA

Cynomolgus Aspartate aminotransferase / GOT1 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Myc Etiqueta

Folha de dadosAnálisesProdutos relacionadosProtocolos
Cynomolgus GOT1 Informações sobre o produto de clone de cDNA
Gene_bank_ref_id:NM_001284930.1
Tamanho de cDNA:1242bp
Descrição de cDNA:Full length Clone DNA of Macaca fascicularis (Crab-eating macaque) (Cynomolgus monkey) Aspartate aminotransferase, cytoplasmic with N terminal Myc tag.
Sinónimo de gene:cCAT, cAspAT
Espécie:Cynomolgus
Vetor:pCMV3-N-Myc
Plasmid:
Local de restrição:
Sequência de etiqueta:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Descrição da sequência:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Cynomolgus Aspartate aminotransferase / GOT1 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Myc Etiqueta on other vectors
Cynomolgus Aspartate aminotransferase / GOT1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-GFPSpark EtiquetaCG90649-ACG$225
Cynomolgus Aspartate aminotransferase / GOT1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-OFPSpark EtiquetaCG90649-ACR$225
Cynomolgus Aspartate aminotransferase / GOT1 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-GFPSpark EtiquetaCG90649-ANG$225
Cynomolgus Aspartate aminotransferase / GOT1 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-OFPSpark EtiquetaCG90649-ANR$225
Cynomolgus Aspartate aminotransferase / GOT1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag EtiquetaCG90649-CF$195
Cynomolgus Aspartate aminotransferase / GOT1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His EtiquetaCG90649-CH$195
Cynomolgus Aspartate aminotransferase / GOT1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Myc EtiquetaCG90649-CM$195
Cynomolgus Aspartate aminotransferase / GOT1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-HA EtiquetaCG90649-CY$195
Cynomolgus Aspartate aminotransferase / GOT1 clonagem de ADN ou de clonagem do gene (vector de expressão)CG90649-G$75
Cynomolgus Aspartate aminotransferase / GOT1 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Flag EtiquetaCG90649-NF$195
Cynomolgus Aspartate aminotransferase / GOT1 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His EtiquetaCG90649-NH$195
Cynomolgus Aspartate aminotransferase / GOT1 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Myc EtiquetaCG90649-NM$195
Cynomolgus Aspartate aminotransferase / GOT1 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-HA EtiquetaCG90649-NY$195
Cynomolgus Aspartate aminotransferase / GOT1 clonagem de ADN ou de clonagem do gene (vector de clonagem)CG90649-UT$195
 Saiba mais sobre vectores de expressão
Product nameProduct name
Fundo

Aspartate aminotransferase is a pyridoxal phosphate-dependent enzyme which exists in cytoplasmic and mitochondrial forms, aspartate aminotransferase and GOT2, respectively. GOT plays a role in amino acid metabolism and the urea and tricarboxylic acid cycles. The two enzymes are homodimeric and show close homology. There is a rare in-frame deletion in aspartate aminotransferase gene, which inactivates cytosolic aspartate aminotransferase(cAST) enzyme in the Old Order Amish. This may help to understand structure and function of the enzyme and would be useful for predicting serum aspartate AST levels.

Referências
  • Shen H, et al. (2011) Genome-wide association study identifies genetic variants in GOT1 determining serum aspartate aminotransferase levels. J Hum Genet. 56(11):801-5.
  • Doonan S, et al. (1985) Structural and genetic relationships between cytosolic and mitochondrial isoenzymes. Int J Biochem. 16(12):1193-9.
  • Panteghini M. (1990) Aspartate aminotransferase isoenzymes. Clin Biochem. 23(4):311-9.
  • Bousquet-Lemercier B, et al. (1990) Properties of human liver cytosolic aspartate aminotransferase mRNAs generated by alternative polyadenylation site selection. Biochemistry. 29(22):5293-9.
  • Size / Price
    Catálogo: CG90649-NM
    Preço de catálogo: 
    Preço:      (You Save: )
    Tamanho:
    Quantidade:+-
    Disponibilidade2-3 weeks
    Bulk Discount RequiryAcrescentar a carrinho
    Contact Us
    Imagens
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Tenha em atenção o seguinte: Todos os produtos destinam-se "A FINS EXCLUSIVOS DE INVESTIGAÇÃO E NÃO DEVEM SER UTILIZADOS PARA EFEITOS DE DIAGNÓSTICO OU TERAPÊUTICOS"