After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Encomenda rápida

Text Size:AAA

Cynomolgus GDI1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His Etiqueta

Folha de dadosAnálisesProdutos relacionadosProtocolos
Cynomolgus GDI1 Informações sobre o produto de clone de cDNA
Tamanho de cDNA:1344bp
Descrição de cDNA:Full length Clone DNA of Macaca fascicularis (Crab-eating macaque) (Cynomolgus monkey) GDP dissociation inhibitor 1 with C terminal His tag.
Sinónimo de gene:GDI-1, QccE-14779
Local de restrição:
Sequência de etiqueta:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Descrição da sequência:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Cynomolgus GDI1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His Etiqueta on other vectors
Cynomolgus GDI1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-GFPSpark EtiquetaCG90813-ACG$225
Cynomolgus GDI1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-OFPSpark EtiquetaCG90813-ACR$225
Cynomolgus GDI1 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-GFPSpark EtiquetaCG90813-ANG$225
Cynomolgus GDI1 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-OFPSpark EtiquetaCG90813-ANR$225
Cynomolgus GDI1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag EtiquetaCG90813-CF$195
Cynomolgus GDI1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His EtiquetaCG90813-CH$195
Cynomolgus GDI1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Myc EtiquetaCG90813-CM$195
Cynomolgus GDI1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-HA EtiquetaCG90813-CY$195
Cynomolgus GDI1 clonagem de ADN ou de clonagem do gene (vector de expressão)CG90813-G$75
Cynomolgus GDI1 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Flag EtiquetaCG90813-NF$195
Cynomolgus GDI1 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His EtiquetaCG90813-NH$195
Cynomolgus GDI1 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Myc EtiquetaCG90813-NM$195
Cynomolgus GDI1 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-HA EtiquetaCG90813-NY$195
Cynomolgus GDI1 clonagem de ADN ou de clonagem do gene (vector de clonagem)CG90813-UT$195
 Saiba mais sobre vectores de expressão
Product nameProduct name
Size / Price
Catálogo: CG90813-CH
Preço de catálogo: 
Preço:      (You Save: )
Disponibilidade2-3 weeks
Bulk Discount RequiryAcrescentar a carrinho
Contact Us
      Itens recentemente visualizados
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.