After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Encomenda rápida

Text Size:AAA

Rhesus GABARAP / Apg8p1 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Flag Etiqueta

Folha de dadosAnálisesProdutos relacionadosProtocolos
Cynomolgus GABARAP Informações sobre o produto de clone de cDNA
Tamanho de cDNA:354bp
Descrição de cDNA:Full length Clone DNA of Macaca mulatta (Rhesus monkey) GABA(A) receptor-associated protein with N terminal Flag tag.
Sinónimo de gene:GABARAP
Local de restrição:
Sequência de etiqueta:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Descrição da sequência:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Rhesus GABARAP / Apg8p1 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Flag Etiqueta on other vectors
Rhesus GABARAP / Apg8p1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-GFPSpark EtiquetaCG90446-ACG$225
Rhesus GABARAP / Apg8p1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-OFPSpark EtiquetaCG90446-ACR$225
Rhesus GABARAP / Apg8p1 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-GFPSpark EtiquetaCG90446-ANG$225
Rhesus GABARAP / Apg8p1 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-OFPSpark EtiquetaCG90446-ANR$225
Rhesus GABARAP / Apg8p1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag EtiquetaCG90446-CF$195
Rhesus GABARAP / Apg8p1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His EtiquetaCG90446-CH$195
Rhesus GABARAP / Apg8p1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Myc EtiquetaCG90446-CM$195
Rhesus GABARAP / Apg8p1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-HA EtiquetaCG90446-CY$195
Rhesus GABARAP / Apg8p1 clonagem de ADN ou de clonagem do gene (vector de expressão)CG90446-G$75
Rhesus GABARAP / Apg8p1 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Flag EtiquetaCG90446-NF$195
Rhesus GABARAP / Apg8p1 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His EtiquetaCG90446-NH$195
Rhesus GABARAP / Apg8p1 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Myc EtiquetaCG90446-NM$195
Rhesus GABARAP / Apg8p1 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-HA EtiquetaCG90446-NY$195
Rhesus GABARAP / Apg8p1 clonagem de ADN ou de clonagem do gene (vector de clonagem)CG90446-UT$195
 Saiba mais sobre vectores de expressão
Product nameProduct name
Size / Price
Catálogo: CG90446-NF
Preço de catálogo: 
Preço:      (You Save: )
Disponibilidade2-3 weeks
Bulk Discount RequiryAcrescentar a carrinho
Contact Us
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.