Encomenda rápida

Rhesus FGF12 / FGF-12 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Myc Etiqueta

    Folha de dadosAnálisesProdutos relacionadosProtocolos
    Cynomolgus FGF12 Informações sobre o produto de clone de cDNA
    Gene_bank_ref_id:NM_001194006.1
    Tamanho de cDNA:732bp
    Descrição de cDNA:Full length Clone DNA of Macaca mulatta (Rhesus monkey) fibroblast growth factor 12 with C terminal Myc tag.
    Sinónimo de gene:FGF12
    Espécie:Rhesus
    Vetor:pCMV3-C-Myc
    Plasmid:
    Local de restrição:
    Sequência de etiqueta:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
    Descrição da sequência:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
    Myc Tag Info

    A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

    A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

    The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

    Rhesus FGF12 / FGF-12 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Myc Etiqueta on other vectors
    Rhesus FGF12 / FGF-12 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-GFPSpark EtiquetaCG90074-ACG$225
    Rhesus FGF12 / FGF-12 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-OFPSpark EtiquetaCG90074-ACR$225
    Rhesus FGF12 / FGF-12 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-GFPSpark EtiquetaCG90074-ANG$225
    Rhesus FGF12 / FGF-12 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-OFPSpark EtiquetaCG90074-ANR$225
    Rhesus FGF12 / FGF-12 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag EtiquetaCG90074-CF$195
    Rhesus FGF12 / FGF-12 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His EtiquetaCG90074-CH$195
    Rhesus FGF12 / FGF-12 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Myc EtiquetaCG90074-CM$195
    Rhesus FGF12 / FGF-12 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-HA EtiquetaCG90074-CY$195
    Rhesus FGF12 / FGF-12 clonagem de ADN ou de clonagem do gene (vector de expressão)CG90074-G$75
    Rhesus FGF12 / FGF-12 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Flag EtiquetaCG90074-NF$195
    Rhesus FGF12 / FGF-12 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His EtiquetaCG90074-NH$195
    Rhesus FGF12 / FGF-12 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Myc EtiquetaCG90074-NM$195
    Rhesus FGF12 / FGF-12 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-HA EtiquetaCG90074-NY$195
    Rhesus FGF12 / FGF-12 clonagem de ADN ou de clonagem do gene (vector de clonagem)CG90074-UT$195
     Saiba mais sobre vectores de expressão
    Product nameProduct name
    Fundo

    FGF12 is a member of the fibroblast growth factor (FGF) family. FGF family members possess broad mitogenic and cell survival activities, and are involved in a variety of biological processes, including embryonic development, cell growth, morphogenesis, tissue repair, tumor growth, and invasion. FGF12 lacks the N-terminal signal sequence present in most of the FGF family members, but it contains clusters of basic residues that have been demonstrated to act as a nuclear localization signal. When transfected into mammalian cells, FGF12 accumulated in the nucleus, but was not secreted. The specific function of FGF12 gene has not yet been determined. Two alternatively spliced transcript variants encoding distinct isoforms have been reported.

    Referências
  • Liu Y. et al., 1997, Cytogenet Cell Genet. 78 (1): 48-9.
  • Robertson NG. et al., 1995, Genomics. 23 (1): 42-50.
  • Smallwood PM. et al., 1996, Proc Natl Acad Sci. 93 (18): 9850-7.
  • Size / Price
    Catálogo: CG90074-CM
    Preço de catálogo: 
    Preço:      (You Save: )
    Tamanho:
    Quantidade:+-
    Disponibilidade
    Acrescentar a carrinhoBulk Discount Requiry

    Datasheet & Documentation

    Contact Us
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Tenha em atenção o seguinte: Todos os produtos destinam-se "A FINS EXCLUSIVOS DE INVESTIGAÇÃO E NÃO DEVEM SER UTILIZADOS PARA EFEITOS DE DIAGNÓSTICO OU TERAPÊUTICOS"