After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Encomenda rápida

Text Size:AAA

Cynomolgus FBXO44 clonagem de ADN ou de clonagem do gene (vector de clonagem)

Folha de dadosAnálisesProdutos relacionadosProtocolos
Cynomolgus FBXO44 Informações sobre o produto de clone de cDNA
Gene_bank_ref_id:XM_005544792.1
Tamanho de cDNA:675bp
Descrição de cDNA:Full length Clone DNA of Macaca fascicularis (Crab-eating macaque) (Cynomolgus monkey) F-box protein 44.
Sinónimo de gene:FBXO44
Espécie:Cynomolgus
Vetor:pCMV3-untagged
Plasmid:
Local de restrição:
Sequência de etiqueta:
Descrição da sequência:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
Cynomolgus FBXO44 clonagem de ADN ou de clonagem do gene (vector de clonagem) on other vectors
Cynomolgus FBXO44 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-GFPSpark EtiquetaCG90724-ACG$225
Cynomolgus FBXO44 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-OFPSpark EtiquetaCG90724-ACR$225
Cynomolgus FBXO44 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-GFPSpark EtiquetaCG90724-ANG$225
Cynomolgus FBXO44 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-OFPSpark EtiquetaCG90724-ANR$225
Cynomolgus FBXO44 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag EtiquetaCG90724-CF$195
Cynomolgus FBXO44 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His EtiquetaCG90724-CH$195
Cynomolgus FBXO44 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Myc EtiquetaCG90724-CM$195
Cynomolgus FBXO44 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-HA EtiquetaCG90724-CY$195
Cynomolgus FBXO44 clonagem de ADN ou de clonagem do gene (vector de expressão)CG90724-G$75
Cynomolgus FBXO44 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Flag EtiquetaCG90724-NF$195
Cynomolgus FBXO44 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His EtiquetaCG90724-NH$195
Cynomolgus FBXO44 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Myc EtiquetaCG90724-NM$195
Cynomolgus FBXO44 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-HA EtiquetaCG90724-NY$195
Cynomolgus FBXO44 clonagem de ADN ou de clonagem do gene (vector de clonagem)CG90724-UT$195
 Saiba mais sobre vectores de expressão
Product nameProduct name
Size / Price
Catálogo: CG90724-UT
Preço de catálogo: 
Preço:      (You Save: )
Tamanho:
Quantidade:+-
Disponibilidade2-3 weeks
Bulk Discount RequiryAcrescentar a carrinho
All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
Tenha em atenção o seguinte: Todos os produtos destinam-se "A FINS EXCLUSIVOS DE INVESTIGAÇÃO E NÃO DEVEM SER UTILIZADOS PARA EFEITOS DE DIAGNÓSTICO OU TERAPÊUTICOS"