After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Cynomolgus fumarylacetoacetate hydrolase clonagem de ADN ou de clonagem do gene (vector de clonagem)

Folha de dadosAnálisesProdutos relacionadosProtocolos
Cynomolgus FAH Informações sobre o produto de clone de cDNA
Gene_bank_ref_id:XM_005560246.1
Tamanho de cDNA:1260bp
Descrição de cDNA:Full length Clone DNA of Macaca fascicularis (Crab-eating macaque) (Cynomolgus monkey) fumarylacetoacetate hydrolase (fumarylacetoacetase).
Sinónimo de gene:FAH
Espécie:Cynomolgus
Vetor:pCMV3-untagged
Plasmid:
Local de restrição:
Sequência de etiqueta:
Descrição da sequência:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
Cynomolgus fumarylacetoacetate hydrolase clonagem de ADN ou de clonagem do gene (vector de clonagem) on other vectors
Cynomolgus fumarylacetoacetate hydrolase clonagem de ADN ou de clonagem do gene (vector de clonagem), C-GFPSpark EtiquetaCG90717-ACG$225
Cynomolgus fumarylacetoacetate hydrolase clonagem de ADN ou de clonagem do gene (vector de clonagem), C-OFPSpark EtiquetaCG90717-ACR$225
Cynomolgus fumarylacetoacetate hydrolase clonagem de ADN ou de clonagem do gene (vector de clonagem), N-GFPSpark EtiquetaCG90717-ANG$225
Cynomolgus fumarylacetoacetate hydrolase clonagem de ADN ou de clonagem do gene (vector de clonagem), N-OFPSpark EtiquetaCG90717-ANR$225
Cynomolgus fumarylacetoacetate hydrolase clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag EtiquetaCG90717-CF$195
Cynomolgus fumarylacetoacetate hydrolase clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His EtiquetaCG90717-CH$195
Cynomolgus fumarylacetoacetate hydrolase clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Myc EtiquetaCG90717-CM$195
Cynomolgus fumarylacetoacetate hydrolase clonagem de ADN ou de clonagem do gene (vector de clonagem), C-HA EtiquetaCG90717-CY$195
Cynomolgus fumarylacetoacetate hydrolase clonagem de ADN ou de clonagem do gene (vector de expressão)CG90717-G$75
Cynomolgus fumarylacetoacetate hydrolase clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Flag EtiquetaCG90717-NF$195
Cynomolgus fumarylacetoacetate hydrolase clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His EtiquetaCG90717-NH$195
Cynomolgus fumarylacetoacetate hydrolase clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Myc EtiquetaCG90717-NM$195
Cynomolgus fumarylacetoacetate hydrolase clonagem de ADN ou de clonagem do gene (vector de clonagem), N-HA EtiquetaCG90717-NY$195
Cynomolgus fumarylacetoacetate hydrolase clonagem de ADN ou de clonagem do gene (vector de clonagem)CG90717-UT$195
 Saiba mais sobre vectores de expressão
Product nameProduct name
Size / Price
Catálogo: CG90717-UT
Preço de catálogo: 
Preço:      (You Save: )
Tamanho:
Quantidade:+-
Disponibilidade2-3 weeks
Bulk Discount RequiryAcrescentar a carrinho
Contact Us
Imagens
      Itens recentemente visualizados
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Tenha em atenção o seguinte: Todos os produtos destinam-se "A FINS EXCLUSIVOS DE INVESTIGAÇÃO E NÃO DEVEM SER UTILIZADOS PARA EFEITOS DE DIAGNÓSTICO OU TERAPÊUTICOS"