Encomenda rápida

Text Size:AAA

Rhesus ENO1 / Enolase 1 / alpha-enolase clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His Etiqueta

Folha de dadosAnálisesProdutos relacionadosProtocolos
Cynomolgus ENO1 Informações sobre o produto de clone de cDNA
Tamanho de cDNA:1305bp
Descrição de cDNA:Full length Clone DNA of Macaca mulatta (Rhesus monkey) enolase 1, (alpha) with C terminal His tag.
Sinónimo de gene:ENO1
Local de restrição:
Sequência de etiqueta:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Descrição da sequência:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Rhesus ENO1 / Enolase 1 / alpha-enolase clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His Etiqueta on other vectors
Rhesus ENO1 / Enolase 1 / alpha-enolase clonagem de ADN ou de clonagem do gene (vector de clonagem), C-GFPSpark EtiquetaCG90355-ACG$225
Rhesus ENO1 / Enolase 1 / alpha-enolase clonagem de ADN ou de clonagem do gene (vector de clonagem), C-OFPSpark EtiquetaCG90355-ACR$225
Rhesus ENO1 / Enolase 1 / alpha-enolase clonagem de ADN ou de clonagem do gene (vector de clonagem), N-GFPSpark EtiquetaCG90355-ANG$225
Rhesus ENO1 / Enolase 1 / alpha-enolase clonagem de ADN ou de clonagem do gene (vector de clonagem), N-OFPSpark EtiquetaCG90355-ANR$225
Rhesus ENO1 / Enolase 1 / alpha-enolase clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag EtiquetaCG90355-CF$195
Rhesus ENO1 / Enolase 1 / alpha-enolase clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His EtiquetaCG90355-CH$195
Rhesus ENO1 / Enolase 1 / alpha-enolase clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Myc EtiquetaCG90355-CM$195
Rhesus ENO1 / Enolase 1 / alpha-enolase clonagem de ADN ou de clonagem do gene (vector de clonagem), C-HA EtiquetaCG90355-CY$195
Rhesus ENO1 / Enolase 1 / alpha-enolase clonagem de ADN ou de clonagem do gene (vector de expressão)CG90355-G$75
Rhesus ENO1 / Enolase 1 / alpha-enolase clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Flag EtiquetaCG90355-NF$195
Rhesus ENO1 / Enolase 1 / alpha-enolase clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His EtiquetaCG90355-NH$195
Rhesus ENO1 / Enolase 1 / alpha-enolase clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Myc EtiquetaCG90355-NM$195
Rhesus ENO1 / Enolase 1 / alpha-enolase clonagem de ADN ou de clonagem do gene (vector de clonagem), N-HA EtiquetaCG90355-NY$195
Rhesus ENO1 / Enolase 1 / alpha-enolase clonagem de ADN ou de clonagem do gene (vector de clonagem)CG90355-UT$195
 Saiba mais sobre vectores de expressão
Product nameProduct name
  • Capello M, et al. (2011) a-Enolase: a promising therapeutic and diagnostic tumor target. FEBS J. 278(7): 1064-74.
  • Kang HJ, et al. (2008) Structure of human alpha-enolase (hENO1), a multifunctional glycolytic enzyme. Acta Crystallogr D Biol Crystallogr. 64(Pt 6): 651-7.
  • Lopez-Alemany R, et al. (2005) Alpha-enolase plasminogen receptor in myogenesis. Front Biosci. 10: 30-6.
  • Ejeskdr K, et al. (2005) Introduction of in vitro transcribed ENO1 mRNA into neuroblastoma cells induces cell death. BMC Cancer. 5: 161.
  • Size / Price
    Catálogo: CG90355-CH
    Preço de catálogo: 
    Preço:      (You Save: )
    Disponibilidade2-3 weeks
    Bulk Discount RequiryAcrescentar a carrinho
    Contact Us
        Itens recentemente visualizados
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.