After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Encomenda rápida

Text Size:AAA

Rhesus ENO1 / Enolase 1 / alpha-enolase clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His Etiqueta

Folha de dadosAnálisesProdutos relacionadosProtocolos
Cynomolgus ENO1 Informações sobre o produto de clone de cDNA
Gene_bank_ref_id:NM_001195611.1
Tamanho de cDNA:1305bp
Descrição de cDNA:Full length Clone DNA of Macaca mulatta (Rhesus monkey) enolase 1, (alpha) with C terminal His tag.
Sinónimo de gene:ENO1
Espécie:Rhesus
Vetor:pCMV3-C-His
Plasmid:
Local de restrição:
Sequência de etiqueta:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Descrição da sequência:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Rhesus ENO1 / Enolase 1 / alpha-enolase clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His Etiqueta on other vectors
Rhesus ENO1 / Enolase 1 / alpha-enolase clonagem de ADN ou de clonagem do gene (vector de clonagem), C-GFPSpark EtiquetaCG90355-ACG$225
Rhesus ENO1 / Enolase 1 / alpha-enolase clonagem de ADN ou de clonagem do gene (vector de clonagem), C-OFPSpark EtiquetaCG90355-ACR$225
Rhesus ENO1 / Enolase 1 / alpha-enolase clonagem de ADN ou de clonagem do gene (vector de clonagem), N-GFPSpark EtiquetaCG90355-ANG$225
Rhesus ENO1 / Enolase 1 / alpha-enolase clonagem de ADN ou de clonagem do gene (vector de clonagem), N-OFPSpark EtiquetaCG90355-ANR$225
Rhesus ENO1 / Enolase 1 / alpha-enolase clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag EtiquetaCG90355-CF$195
Rhesus ENO1 / Enolase 1 / alpha-enolase clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His EtiquetaCG90355-CH$195
Rhesus ENO1 / Enolase 1 / alpha-enolase clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Myc EtiquetaCG90355-CM$195
Rhesus ENO1 / Enolase 1 / alpha-enolase clonagem de ADN ou de clonagem do gene (vector de clonagem), C-HA EtiquetaCG90355-CY$195
Rhesus ENO1 / Enolase 1 / alpha-enolase clonagem de ADN ou de clonagem do gene (vector de expressão)CG90355-G$75
Rhesus ENO1 / Enolase 1 / alpha-enolase clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Flag EtiquetaCG90355-NF$195
Rhesus ENO1 / Enolase 1 / alpha-enolase clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His EtiquetaCG90355-NH$195
Rhesus ENO1 / Enolase 1 / alpha-enolase clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Myc EtiquetaCG90355-NM$195
Rhesus ENO1 / Enolase 1 / alpha-enolase clonagem de ADN ou de clonagem do gene (vector de clonagem), N-HA EtiquetaCG90355-NY$195
Rhesus ENO1 / Enolase 1 / alpha-enolase clonagem de ADN ou de clonagem do gene (vector de clonagem)CG90355-UT$195
 Saiba mais sobre vectores de expressão
Product nameProduct name
Referências
  • Capello M, et al. (2011) a-Enolase: a promising therapeutic and diagnostic tumor target. FEBS J. 278(7): 1064-74.
  • Kang HJ, et al. (2008) Structure of human alpha-enolase (hENO1), a multifunctional glycolytic enzyme. Acta Crystallogr D Biol Crystallogr. 64(Pt 6): 651-7.
  • Lopez-Alemany R, et al. (2005) Alpha-enolase plasminogen receptor in myogenesis. Front Biosci. 10: 30-6.
  • Ejeskdr K, et al. (2005) Introduction of in vitro transcribed ENO1 mRNA into neuroblastoma cells induces cell death. BMC Cancer. 5: 161.
  • Size / Price
    Catálogo: CG90355-CH
    Preço de catálogo: 
    Preço:      (You Save: )
    Tamanho:
    Quantidade:+-
    Disponibilidade2-3 weeks
    Bulk Discount RequiryAcrescentar a carrinho
    Contact Us
    Imagens
        Itens recentemente visualizados
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          Tenha em atenção o seguinte: Todos os produtos destinam-se "A FINS EXCLUSIVOS DE INVESTIGAÇÃO E NÃO DEVEM SER UTILIZADOS PARA EFEITOS DE DIAGNÓSTICO OU TERAPÊUTICOS"