Encomenda rápida

Text Size:AAA

Rhesus BCA-1 / CXCL13 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Myc Etiqueta

Folha de dadosAnálisesProdutos relacionadosProtocolos
Cynomolgus CXCL13 Informações sobre o produto de clone de cDNA
Tamanho de cDNA:330bp
Descrição de cDNA:Full length Clone DNA of Macaca mulatta (Rhesus monkey) chemokine (C-X-C motif) ligand 13 with N terminal Myc tag.
Sinónimo de gene:CXCL13, BLC
Local de restrição:
Sequência de etiqueta:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Descrição da sequência:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Product nameProduct name

The chemokine CXCL13, also known as BCA-1 (B-cell-attracting chemokine-1) or BLC (B-lymphocyte chemoattractant), which belongs to the CXC chemokine family. CXCL13 and its receptor CXCR5 control the organization of B cells within follicles of lymphoid tissues. CXCL13 is known to dictate homing and motility of B cells in lymphoid tissue and has been implicated in the formation of ectopic lymphoid tissue in chronic inflammation. It involves in B-cell compartmental homing within secondary lymphoid organs and recently implicated in the pathogenesis of inflammatory and malignant lymphocyte-mediated diseases. In Primary central nervous system lymphoma (PCNSL), expression of BCA-1 by malignant lymphocytes and vascular endothelium may influence tumor development and localization to central nervous system (CNS). In T-lymphocytes, CXCL13 expression is thought to reflect a germinal center origin of the T-cell. CXCL13 expression may also provide an additional useful tool for the diagnosis of Angioimmunoblastic T-cell lymphoma (AITL).

  • Ansel KM, et al. (2000) A chemokine-driven positive feedback loop organizes lymphoid follicles. Nature. 406 (6793): 309-14.
  • Smith JR, et al. (2003) Expression of B-cell-attracting chemokine 1 (CXCL13) by malignant lymphocytes and vascular endothelium in primary central nervous system lymphoma. Blood. 101(3): 815-21.
  • Dupuis J, et al. (2006) Expression of CXCL13 by neoplastic cells in angioimmunoblastic T-cell lymphoma (AITL): a new diagnostic marker providing evidence that AITL derives from follicular helper T cells. Am J Surg Pathol. 30(4): 490-4.
  • de Leval L, et al. (2007) The gene expression profile of nodal peripheral T-cell lymphoma demonstrates a molecular link between angioimmunoblastic T-cell lymphoma (AITL) and follicular helper T (TFH) cells. Blood. 109 (11): 4952-63.
  • Schiffer L, et al. (2009) B-cell-attracting chemokine CXCL13 as a marker of disease activity and renal involvement in systemic lupus erythematosus (SLE). Nephrol Dial Transplant. 24(12): 3708-12.
  • Rupprecht TA, et al. (2009) The chemokine CXCL13 is a key regulator of B cell recruitment to the cerebrospinal fluid in acute Lyme neuroborreliosis. J Neuroinflammation. 6: 42.
  • All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.