After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Rhesus SDF-1/CXCL12 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Myc Etiqueta

Folha de dadosAnálisesProdutos relacionadosProtocolos
Cynomolgus CXCL12 Informações sobre o produto de clone de cDNA
Gene_bank_ref_id:NM_001032934.1
Tamanho de cDNA:270bp
Descrição de cDNA:Full length Clone DNA of Macaca mulatta (Rhesus monkey) chemokine (C-X-C motif) ligand 12 with N terminal Myc tag.
Sinónimo de gene:Img, LIG-1, D6Bwg0781e, Lrig1
Espécie:Rhesus
Vetor:pCMV3-SP-N-Myc
Plasmid:
Local de restrição:
Sequência de etiqueta:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Descrição da sequência:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Product nameProduct name
Fundo

The human stromal cell-derived factor-1 (SDF1), also known as CXCL12, is a small (8 kDa) cytokine highly conserved chemotactic cytokine belonging to the large family of CXC chemokines. SDF1 is expressed in two isoforms from a single gene that encodes two splice variants, SDF1α and SDF1β, which are identical except for the four residues present in the C-terminus of SDF1β but absent from SDF1α. The chemokine CXCL12 [stromal cell-derived factor-1 (SDF-1)] binds primarily to CXC receptor 4 (CXCR4; CD184). The binding of CXCL12 to CXCR4 induces intracellular signaling through several divergent pathways initiating signals related to chemotaxis, cell survival and/or proliferation, increase in intracellular calcium, and gene transcription. CXCL12 and CXCR4 that have been widely characterized in peripheral tissues and delineate their main functions in the CNS. Extensive evidence supports CXCL12 as a key regulator for early development of the CNS. In the mature CNS, CXCL12 modulates neurotransmission, neurotoxicity and neuroglial interactions. CXCL12 has crucial roles in the formation of multiple organ systems during embryogenesis and in the regulation of bone marrow haematopoiesis and immune function in the postnatal organism. Although considered an important factor in normal bone metabolism, recent studies implicate CXCL12 in the pathogenesis of several diseases involving the skeleton, including rheumatoid arthritis and cancers that metastasize to bone. The CXCL12/CXCR4 axis is involved in tumor progression, angiogenesis, metastasis, and survival. Pathologically enhanced CXCL12 signaling may promote the formation of new vessels through recruiting circulating endothelial progenitor cells or directly enhancing the migration/growth of endothelial cells. Therefore, CXCL12 signaling represents an important mechanism that regulates brain tumor angiogenesis/vasculogenesis and may provide potential targets for anti-angiogenic therapy in malignant gliomas.

Referências
  • Bleul, C.C. et al., 1996, Nature. 382: 829-833.
  • Sapede, D. et al., 2005, Proc. Natl. Acad. Sci. USA. 102: 1714-1718.
  • Delgado, M.B. et al., 2001, Eur. J. Immunol. 31: 699-707.
  • Orimo, A. et al., 2005, Cell. 121: 335-348.
  • Kryczek, I. et al., 2007, Am. J. Physiol. Cell. Physiol. 292: C987-995.
  • Bbalabanian, K. et al., 2005, J. Biol. Chem. 280: 35760-35766.
  • Size / Price
    Catálogo: CG90009-NM
    Preço de catálogo: 
    Preço:      (You Save: )
    Tamanho:
    Quantidade:+-
    Disponibilidade2-3 weeks
    Bulk Discount RequiryAcrescentar a carrinho
    Contact Us
    Imagens
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Tenha em atenção o seguinte: Todos os produtos destinam-se "A FINS EXCLUSIVOS DE INVESTIGAÇÃO E NÃO DEVEM SER UTILIZADOS PARA EFEITOS DE DIAGNÓSTICO OU TERAPÊUTICOS"