After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Encomenda rápida

Text Size:AAA

Rhesus CSNK2A1 ORF mammalian expression plasmid, C-Myc tag

Folha de dadosAnálisesProdutos relacionadosProtocolos
Cynomolgus CSNK2A1 Informações sobre o produto de clone de cDNA
Gene_bank_ref_id:NM_001260877.1
Tamanho de cDNA:1176bp
Descrição de cDNA:Full length Clone DNA of Macaca mulatta (Rhesus monkey) casein kinase 2, alpha 1 polypeptide with C terminal Myc tag.
Sinónimo de gene:CSNK2A1
Espécie:Rhesus
Vetor:pCMV3-C-Myc
Plasmid:
Local de restrição:
Sequência de etiqueta:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Descrição da sequência:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Product nameProduct name
Fundo

Casein kinase II subunit alpha, also known as CK II alpha, CSNK2A1 and CK2A1, is a member of the protein kinase superfamily, Ser / Thr protein kinase family and CK2 subfamily. Casein kinase II (CSNK2A1) is a serine / threonine protein kinase that phosphorylates acidic proteins such as casein. This kinase is composed of an alpha, an alpha-prime, and two beta subunits. The alpha subunits contain the catalytic activity while the beta subunits undergo autophosphorylation. Casein kinase II (CSNK2A1) is a constitutively active, ubiquitously expressed serine / threonine protein kinase that is thought to have a regulatory function in cell proliferation, cell differentiation and apoptosis. CSNK2A1 functions as a tetrameric complex consisting of two regulatory beta-subunits and two catalytic units (alpha and alpha') in a homomeric or heteromeric conformation. Whilst the alpha- and alpha'-subunits are catalytically identical, proteins that regulate CSNK2A1, such as cdc2 and Hsp90, preferentially bind to the alpha and not the alpha'-subunit. CSNK2A1 can phosphorylate a number of key intracellular signaling proteins implicated in tumor suppression (p53 and PTEN) and tumorigenesis (myc, jun, NF-kappaB). CSNK2A1 is also thought to influence Wnt signaling via beta-catenin phosphorylation and the PI 3-K signaling pathway via th phosphorylation of Akt.

Referências
  • Schlpfer J, et al. (1997) A radiation hybrid framework map of bovine chromosome 13. Chromosome Res. 5(8): 511-9.
  • Wirkner U, et al. (1994) The human gene (CSNK2A1) coding for the casein kinase II subunit alpha is located on chromosome 20 and contains tandemly arranged Alu repeats. Genomics. 19(2): 257-65.
  • Wirkner U, et al. (1998) Genomic organization and promoter identification of the human protein kinase CK2 catalytic subunit alpha (CSNK2A1). Genomics. 48(1): 71-8.
  • Size / Price
    Catálogo: CG90444-CM
    Preço de catálogo:   (Save )
    Preço:      [How to order]
    Disponibilidade
     Instruções de envio
    Imagens
        Itens recentemente visualizados
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          Tenha em atenção o seguinte: Todos os produtos destinam-se "A FINS EXCLUSIVOS DE INVESTIGAÇÃO E NÃO DEVEM SER UTILIZADOS PARA EFEITOS DE DIAGNÓSTICO OU TERAPÊUTICOS"