Encomenda rápida

Rhesus JAB1/CSN5 clonagem de ADN ou de clonagem do gene (vector de clonagem)

Folha de dadosAnálisesProdutos relacionadosProtocolos
Cynomolgus COPS5 Informações sobre o produto de clone de cDNA
Gene_bank_ref_id:NM_001260680.1
Tamanho de cDNA:1005bp
Descrição de cDNA:Full length Clone DNA of Macaca mulatta (Rhesus monkey) COP9 constitutive photomorphogenic homolog subunit 5 (Arabidopsis).
Sinónimo de gene:COPS5
Espécie:Rhesus
Vetor:pCMV3-untagged
Plasmid:
Local de restrição:
Sequência de etiqueta:
Descrição da sequência:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
Rhesus JAB1/CSN5 clonagem de ADN ou de clonagem do gene (vector de clonagem) on other vectors
Rhesus JAB1/CSN5 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-GFPSpark EtiquetaCG90742-ACG$225
Rhesus JAB1/CSN5 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-OFPSpark EtiquetaCG90742-ACR$225
Rhesus JAB1/CSN5 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-GFPSpark EtiquetaCG90742-ANG$225
Rhesus JAB1/CSN5 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-OFPSpark EtiquetaCG90742-ANR$225
Rhesus JAB1/CSN5 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag EtiquetaCG90742-CF$195
Rhesus JAB1/CSN5 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His EtiquetaCG90742-CH$195
Rhesus JAB1/CSN5 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Myc EtiquetaCG90742-CM$195
Rhesus JAB1/CSN5 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-HA EtiquetaCG90742-CY$195
Rhesus JAB1/CSN5 clonagem de ADN ou de clonagem do gene (vector de expressão)CG90742-G$75
Rhesus JAB1/CSN5 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Flag EtiquetaCG90742-NF$195
Rhesus JAB1/CSN5 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His EtiquetaCG90742-NH$195
Rhesus JAB1/CSN5 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Myc EtiquetaCG90742-NM$195
Rhesus JAB1/CSN5 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-HA EtiquetaCG90742-NY$195
Rhesus JAB1/CSN5 clonagem de ADN ou de clonagem do gene (vector de clonagem)CG90742-UT$195
 Saiba mais sobre vectores de expressão
Product nameProduct name
Size / Price
Catálogo: CG90742-UT
Preço de catálogo: 
Preço:      (You Save: )
Tamanho:
Quantidade:+-
Disponibilidade2-3 weeks
Bulk Discount RequiryAcrescentar a carrinho
Contact Us
Imagens
      Itens recentemente visualizados
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Tenha em atenção o seguinte: Todos os produtos destinam-se "A FINS EXCLUSIVOS DE INVESTIGAÇÃO E NÃO DEVEM SER UTILIZADOS PARA EFEITOS DE DIAGNÓSTICO OU TERAPÊUTICOS"