Encomenda rápida

Cynomolgus CHN1 / chimerin 1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-HA Etiqueta

Folha de dadosAnálisesProdutos relacionadosProtocolos
Cynomolgus CHN1 Informações sobre o produto de clone de cDNA
Tamanho de cDNA:1005bp
Descrição de cDNA:Full length Clone DNA of Macaca fascicularis (Crab-eating macaque) (Cynomolgus monkey) chimerin 1 with C terminal HA tag.
Sinónimo de gene:CHN1
Local de restrição:
Sequência de etiqueta:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Descrição da sequência:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Cynomolgus CHN1 / chimerin 1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-HA Etiqueta on other vectors
Cynomolgus CHN1 / chimerin 1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-GFPSpark EtiquetaCG90836-ACG$225
Cynomolgus CHN1 / chimerin 1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-OFPSpark EtiquetaCG90836-ACR$225
Cynomolgus CHN1 / chimerin 1 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-GFPSpark EtiquetaCG90836-ANG$225
Cynomolgus CHN1 / chimerin 1 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-OFPSpark EtiquetaCG90836-ANR$225
Cynomolgus CHN1 / chimerin 1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag EtiquetaCG90836-CF$195
Cynomolgus CHN1 / chimerin 1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His EtiquetaCG90836-CH$195
Cynomolgus CHN1 / chimerin 1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Myc EtiquetaCG90836-CM$195
Cynomolgus CHN1 / chimerin 1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-HA EtiquetaCG90836-CY$195
Cynomolgus CHN1 / chimerin 1 clonagem de ADN ou de clonagem do gene (vector de expressão)CG90836-G$75
Cynomolgus CHN1 / chimerin 1 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Flag EtiquetaCG90836-NF$195
Cynomolgus CHN1 / chimerin 1 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His EtiquetaCG90836-NH$195
Cynomolgus CHN1 / chimerin 1 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Myc EtiquetaCG90836-NM$195
Cynomolgus CHN1 / chimerin 1 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-HA EtiquetaCG90836-NY$195
Cynomolgus CHN1 / chimerin 1 clonagem de ADN ou de clonagem do gene (vector de clonagem)CG90836-UT$195
 Saiba mais sobre vectores de expressão
Product nameProduct name

CHN1, also known as chimerin 1, is a TPase-activating protein for ras-related p21-rac and a phorbol ester receptor. It is predominantly expressed in neurons, and plays an important role in neuronal signal-transduction mechanisms. CHN1 is involved in the assembly of neuronal locomotor circuits as a direct effector of EPHA4 in axon guidance. The CHN1 gene provides instructions for making two very similar proteins called α1-chimaerin and α2-chimaerin. These proteins play an important role in the early development of the nervous system. In particular, they help regulate complex chemical signaling pathways during the formation and development of nerve cells (neurons). These proteins help guide the growth of axons and dendrites, which are specialized extensions of neurons that transmit and receive nerve impulses throughout the nervous system.

  • Miyake N. et al, 2010, Am J Med Genet A. 152 (1): 215-7.
  • Miyake N. et al., 2011, Invest Ophthalmol Vis Sci. 52 (9): 6321-8.
  • Volk AE. et al., 2010, Graefes Arch Clin Exp Ophthalmol. 248 (9): 1351-7.
  • Size / Price
    Catálogo: CG90836-CY
    Preço de catálogo: 
    Preço:      (You Save: )
    Disponibilidade2-3 weeks
    Bulk Discount RequiryAcrescentar a carrinho
    Contact Us
        Itens recentemente visualizados
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.