Encomenda rápida

Cynomolgus CD151 clonagem de ADN ou de clonagem do gene (vector de clonagem)

  • other Green fluorescent protein / GFP Gene Plasmid Map 5613
Folha de dadosAnálisesProdutos relacionadosProtocolos
Cynomolgus CD151 Informações sobre o produto de clone de cDNA
Gene_bank_ref_id:XM_005576813.1
Tamanho de cDNA:762bp
Descrição de cDNA:Full length Clone DNA of Macaca fascicularis (Crab-eating macaque) (Cynomolgus monkey) CD151 molecule (Raph blood group).
Sinónimo de gene:CD151
Espécie:Cynomolgus
Vetor:pCMV3-untagged
Plasmid:pCMV3-cynoCD151
Local de restrição:KpnI + XbaI(6.1kb+0.76kb)
Sequência de etiqueta:
Descrição da sequência:Identical with the Gene Bank Ref. ID sequence except for the point mutations: 204C/T,411G/A,537C/G not causing the amino acid variation.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicillin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
Product nameProduct name
Size / Price
Catálogo: CG90749-UT
Preço de catálogo: 
Preço:      (You Save: )
Tamanho:
Quantidade:+-
DisponibilidadeIn Stock
Acrescentar a carrinhoBulk Discount Requiry

Datasheet & Documentation

Contact Us
    Itens recentemente visualizados
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Tenha em atenção o seguinte: Todos os produtos destinam-se "A FINS EXCLUSIVOS DE INVESTIGAÇÃO E NÃO DEVEM SER UTILIZADOS PARA EFEITOS DE DIAGNÓSTICO OU TERAPÊUTICOS"