Encomenda rápida

Cynomolgus ATF-4 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His Etiqueta

    Folha de dadosAnálisesProdutos relacionadosProtocolos
    Cynomolgus ATF4 Informações sobre o produto de clone de cDNA
    Gene_bank_ref_id:XM_005567221.1
    Tamanho de cDNA:1056bp
    Descrição de cDNA:Full length Clone DNA of Macaca fascicularis (Crab-eating macaque) (Cynomolgus monkey) activating transcription factor 4 with C terminal His tag.
    Sinónimo de gene:ATF4
    Espécie:Cynomolgus
    Vetor:pCMV3-C-His
    Plasmid:
    Local de restrição:
    Sequência de etiqueta:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
    Descrição da sequência:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
    His Tag Info

    A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

    Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

    Cynomolgus ATF-4 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His Etiqueta on other vectors
    Cynomolgus ATF-4 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-GFPSpark EtiquetaCG90357-ACG$225
    Cynomolgus ATF-4 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-OFPSpark EtiquetaCG90357-ACR$225
    Cynomolgus ATF-4 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-GFPSpark EtiquetaCG90357-ANG$225
    Cynomolgus ATF-4 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-OFPSpark EtiquetaCG90357-ANR$225
    Cynomolgus ATF-4 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag EtiquetaCG90357-CF$195
    Cynomolgus ATF-4 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His EtiquetaCG90357-CH$195
    Cynomolgus ATF-4 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Myc EtiquetaCG90357-CM$195
    Cynomolgus ATF-4 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-HA EtiquetaCG90357-CY$195
    Cynomolgus ATF-4 clonagem de ADN ou de clonagem do gene (vector de expressão)CG90357-G$75
    Cynomolgus ATF-4 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Flag EtiquetaCG90357-NF$195
    Cynomolgus ATF-4 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His EtiquetaCG90357-NH$195
    Cynomolgus ATF-4 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Myc EtiquetaCG90357-NM$195
    Cynomolgus ATF-4 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-HA EtiquetaCG90357-NY$195
    Cynomolgus ATF-4 clonagem de ADN ou de clonagem do gene (vector de clonagem)CG90357-UT$195
     Saiba mais sobre vectores de expressão
    Product nameProduct name
    Size / Price
    Catálogo: CG90357-CH
    Preço de catálogo: 
    Preço:      (You Save: )
    Tamanho:
    Quantidade:+-
    Disponibilidade
    Acrescentar a carrinhoBulk Discount Requiry

    Datasheet & Documentation

    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Tenha em atenção o seguinte: Todos os produtos destinam-se "A FINS EXCLUSIVOS DE INVESTIGAÇÃO E NÃO DEVEM SER UTILIZADOS PARA EFEITOS DE DIAGNÓSTICO OU TERAPÊUTICOS"