Encomenda rápida

Cynomolgus ARF3 / ADP-ribosylation factor 3 clonagem de ADN ou de clonagem do gene (vector de clonagem)

    Folha de dadosAnálisesProdutos relacionadosProtocolos
    Cynomolgus ARF3 Informações sobre o produto de clone de cDNA
    Gene_bank_ref_id:XM_005570735.1
    Tamanho de cDNA:546bp
    Descrição de cDNA:Full length Clone DNA of Macaca fascicularis (Crab-eating macaque) (Cynomolgus monkey) ADP-ribosylation factor 3.
    Sinónimo de gene:ARF3
    Espécie:Cynomolgus
    Vetor:pCMV3-untagged
    Plasmid:
    Local de restrição:
    Sequência de etiqueta:
    Descrição da sequência:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Ampicillin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
    Cynomolgus ARF3 / ADP-ribosylation factor 3 clonagem de ADN ou de clonagem do gene (vector de clonagem) on other vectors
    Cynomolgus ARF3 / ADP-ribosylation factor 3 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-GFPSpark EtiquetaCG90751-ACG$225
    Cynomolgus ARF3 / ADP-ribosylation factor 3 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-OFPSpark EtiquetaCG90751-ACR$225
    Cynomolgus ARF3 / ADP-ribosylation factor 3 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag EtiquetaCG90751-CF$195
    Cynomolgus ARF3 / ADP-ribosylation factor 3 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His EtiquetaCG90751-CH$195
    Cynomolgus ARF3 / ADP-ribosylation factor 3 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Myc EtiquetaCG90751-CM$195
    Cynomolgus ARF3 / ADP-ribosylation factor 3 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-HA EtiquetaCG90751-CY$195
    Cynomolgus ARF3 / ADP-ribosylation factor 3 clonagem de ADN ou de clonagem do gene (vector de expressão)CG90751-G$75
    Cynomolgus ARF3 / ADP-ribosylation factor 3 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Flag EtiquetaCG90751-NF$195
    Cynomolgus ARF3 / ADP-ribosylation factor 3 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His EtiquetaCG90751-NH$195
    Cynomolgus ARF3 / ADP-ribosylation factor 3 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Myc EtiquetaCG90751-NM$195
    Cynomolgus ARF3 / ADP-ribosylation factor 3 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-HA EtiquetaCG90751-NY$195
    Cynomolgus ARF3 / ADP-ribosylation factor 3 clonagem de ADN ou de clonagem do gene (vector de clonagem)CG90751-UT$195
     Saiba mais sobre vectores de expressão
    Product nameProduct name
    Fundo

    ARF3, also known as ADP-ribosylation factor 3, belongs to the RAS superfamily. Members of this family include ARF1, ARF2, ARF3, ARF4, ARF5 and ARF6. ARF3 gene is a member of the human ARF gene family. These genes encode small guanine nucleotide-binding proteins that stimulate the ADP-ribosyltransferase activity of cholera toxin and play a role in vesicular trafficking and as activators of phospholipase D. ARF3 functions as an allosteric activator of the cholera toxin subunit, an ADP-ribosyltransferase. It is involved in protein trafficking and may modulate vesicle budding and uncoating within the Golgi apparatus.

    Referências
  • Hirai M. et al., 1997, Genomics. 34 (2): 263-5.
  • Kanoh H. et al., 1997, J Biol Chem. 272 (9): 5421-9.
  • Boman. et al., 2002, Mol Biol Cell. 13 (9): 3078-95.
  • Size / Price
    Catálogo: CG90751-UT
    Preço de catálogo: 
    Preço:      (You Save: )
    Tamanho:
    Quantidade:+-
    Disponibilidade
    Acrescentar a carrinhoBulk Discount Requiry

    Datasheet & Documentation

    Contact Us
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Tenha em atenção o seguinte: Todos os produtos destinam-se "A FINS EXCLUSIVOS DE INVESTIGAÇÃO E NÃO DEVEM SER UTILIZADOS PARA EFEITOS DE DIAGNÓSTICO OU TERAPÊUTICOS"