After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Cynomolgus AP1S1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His Etiqueta

Folha de dadosAnálisesProdutos relacionadosProtocolos
Cynomolgus AP1S1 Informações sobre o produto de clone de cDNA
Gene_bank_ref_id:XM_005549285.1
Tamanho de cDNA:477bp
Descrição de cDNA:Full length Clone DNA of Macaca fascicularis (Crab-eating macaque) (Cynomolgus monkey) adaptor-related protein complex 1, sigma 1 subunit with C terminal His tag.
Sinónimo de gene:AP1S1
Espécie:Cynomolgus
Vetor:pCMV3-C-His
Plasmid:
Local de restrição:
Sequência de etiqueta:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Descrição da sequência:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Cynomolgus AP1S1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His Etiqueta on other vectors
Cynomolgus AP1S1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-GFPSpark EtiquetaCG90354-ACG$225
Cynomolgus AP1S1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-OFPSpark EtiquetaCG90354-ACR$225
Cynomolgus AP1S1 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-GFPSpark EtiquetaCG90354-ANG$225
Cynomolgus AP1S1 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-OFPSpark EtiquetaCG90354-ANR$225
Cynomolgus AP1S1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag EtiquetaCG90354-CF$195
Cynomolgus AP1S1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His EtiquetaCG90354-CH$195
Cynomolgus AP1S1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Myc EtiquetaCG90354-CM$195
Cynomolgus AP1S1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-HA EtiquetaCG90354-CY$195
Cynomolgus AP1S1 clonagem de ADN ou de clonagem do gene (vector de expressão)CG90354-G$75
Cynomolgus AP1S1 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Flag EtiquetaCG90354-NF$195
Cynomolgus AP1S1 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His EtiquetaCG90354-NH$195
Cynomolgus AP1S1 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Myc EtiquetaCG90354-NM$195
Cynomolgus AP1S1 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-HA EtiquetaCG90354-NY$195
Cynomolgus AP1S1 clonagem de ADN ou de clonagem do gene (vector de clonagem)CG90354-UT$195
 Saiba mais sobre vectores de expressão
Product nameProduct name
Size / Price
Catálogo: CG90354-CH
Preço de catálogo: 
Preço:      (You Save: )
Tamanho:
Quantidade:+-
Disponibilidade2-3 weeks
Bulk Discount RequiryAcrescentar a carrinho
All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
Tenha em atenção o seguinte: Todos os produtos destinam-se "A FINS EXCLUSIVOS DE INVESTIGAÇÃO E NÃO DEVEM SER UTILIZADOS PARA EFEITOS DE DIAGNÓSTICO OU TERAPÊUTICOS"