Encomenda rápida

Canine HE4/WFDC2/WAP5 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag Etiqueta

Folha de dadosAnálisesProdutos relacionadosProtocolos
Canino WFDC2 Informações sobre o produto de clone de cDNA
Tamanho de cDNA:525bp
Descrição de cDNA:Full length Clone DNA of Canis lupus familiaris WAP four-disulfide core domain 2 with C terminal Flag tag.
Sinónimo de gene:CE4
Local de restrição:
Sequência de etiqueta:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Descrição da sequência:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Product nameProduct name

WAP four-disulfide core domain protein 2, also known as Epididymal secretory protein E4, Major epididymis-specific protein E4, Putative protease inhibitor WAP5, WFDC2 and HE4, is a secreted protein which contains two WAP domains. WFDC2 / HE4 is a member of a family of stable 4-disulfide core proteins that are secreted at high levels. It is expressed in a number of normal tissues, including male reproductive system, regions of the respiratory tract and nasopharynx. It is highly expressed in a number of tumors cells lines, such ovarian, colon, breast, lung and renal cells lines. Initially described as being exclusively transcribed in the epididymis. WFDC2 may be a component of the innate immune defences of the lung, nasal and oral cavities and suggest that WFDC2 functions in concert with related WAP domain containing proteins in epithelial host defence. WFDC2 re-expression in lung carcinomas may prove to be associated with tumour type and should be studied in further detail. Mammary gland expression of tammar WFDC2 during the course of lactation showed WFDC2 was elevated during pregnancy, reduced in early lactation and absent in mid-late lactation. WFDC2 / HE4 can undergo a complex series of alternative splicing events that can potentially yield five distinct WAP domain containing protein isoforms.

  • Bingle,L. et al., 2002, Oncogene. 21 (17):2768-73.
  • Hellström,I. et al., 2003, Cancer Res. 63 (13):3695-700.
  • Bingle,L. et al., 2006, Respir Res. 7 : 61.
  • Galgano,M.T. et al., 2006, Mod Pathol.19 (6):847-53.
  • Sharp,J.A. et al., 2007, Evol Dev. 9 (4): 378-92.
  • Size / Price
    Catálogo: DG70012-CF
    Preço de catálogo: 
    Preço:      (You Save: )
    Acrescentar a carrinhoBulk Discount Requiry
    Contact Us
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.