Encomenda rápida

Canine STMN1 / Stathmin 1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His Etiqueta

    Folha de dadosAnálisesProdutos relacionadosProtocolos
    Canino STMN1 Informações sobre o produto de clone de cDNA
    Tamanho de cDNA:450bp
    Descrição de cDNA:Full length Clone DNA of Canis lupus familiaris stathmin 1 with C terminal His tag.
    Sinónimo de gene:STMN1
    Local de restrição:
    Sequência de etiqueta:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
    Descrição da sequência:
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
    His Tag Info

    A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

    Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

    Canine STMN1 / Stathmin 1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His Etiqueta on other vectors
    Canine STMN1 / Stathmin 1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-GFPSpark EtiquetaDG70212-ACG$225
    Canine STMN1 / Stathmin 1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-OFPSpark EtiquetaDG70212-ACR$225
    Canine STMN1 / Stathmin 1 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-GFPSpark EtiquetaDG70212-ANG$225
    Canine STMN1 / Stathmin 1 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-OFPSpark EtiquetaDG70212-ANR$225
    Canine STMN1 / Stathmin 1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag EtiquetaDG70212-CF$195
    Canine STMN1 / Stathmin 1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His EtiquetaDG70212-CH$195
    Canine STMN1 / Stathmin 1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Myc EtiquetaDG70212-CM$195
    Canine STMN1 / Stathmin 1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-HA EtiquetaDG70212-CY$195
    Canine STMN1 / Stathmin 1 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Flag EtiquetaDG70212-NF$195
    Canine STMN1 / Stathmin 1 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His EtiquetaDG70212-NH$195
    Canine STMN1 / Stathmin 1 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Myc EtiquetaDG70212-NM$195
    Canine STMN1 / Stathmin 1 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-HA EtiquetaDG70212-NY$195
    Canine STMN1 / Stathmin 1 clonagem de ADN ou de clonagem do gene (vector de expressão)DG70212-U$75
    Canine STMN1 / Stathmin 1 clonagem de ADN ou de clonagem do gene (vector de clonagem)DG70212-UT$195
     Saiba mais sobre vectores de expressão
    Product nameProduct name
    Size / Price
    Catálogo: DG70212-CH
    Preço de catálogo: 
    Preço:      (You Save: )
    Acrescentar a carrinhoBulk Discount Requiry

    Datasheet & Documentation

    Contact Us
      Itens recentemente visualizados
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.