After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Canine LC3B / MAP1LC3B clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His Etiqueta

Folha de dadosAnálisesProdutos relacionadosProtocolos
Canine MAP1LC3B Informações sobre o produto de clone de cDNA
Gene_bank_ref_id:XM_536756.4
Tamanho de cDNA:378bp
Descrição de cDNA:Full length Clone DNA of Canis lupus familiaris microtubule-associated protein 1 light chain 3 beta with C terminal His tag.
Sinónimo de gene:MAP1LC3B
Espécie:Canine
Vetor:pCMV3-C-His
Plasmid:
Local de restrição:
Sequência de etiqueta:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Descrição da sequência:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Canine LC3B / MAP1LC3B clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His Etiqueta on other vectors
Canine LC3B / MAP1LC3B clonagem de ADN ou de clonagem do gene (vector de clonagem), C-GFPSpark EtiquetaDG70200-ACG$225
Canine LC3B / MAP1LC3B clonagem de ADN ou de clonagem do gene (vector de clonagem), C-OFPSpark EtiquetaDG70200-ACR$225
Canine LC3B / MAP1LC3B clonagem de ADN ou de clonagem do gene (vector de clonagem), N-GFPSpark EtiquetaDG70200-ANG$225
Canine LC3B / MAP1LC3B clonagem de ADN ou de clonagem do gene (vector de clonagem), N-OFPSpark EtiquetaDG70200-ANR$225
Canine LC3B / MAP1LC3B clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag EtiquetaDG70200-CF$195
Canine LC3B / MAP1LC3B clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His EtiquetaDG70200-CH$195
Canine LC3B / MAP1LC3B clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Myc EtiquetaDG70200-CM$195
Canine LC3B / MAP1LC3B clonagem de ADN ou de clonagem do gene (vector de clonagem), C-HA EtiquetaDG70200-CY$195
Canine LC3B / MAP1LC3B clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Flag EtiquetaDG70200-NF$195
Canine LC3B / MAP1LC3B clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His EtiquetaDG70200-NH$195
Canine LC3B / MAP1LC3B clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Myc EtiquetaDG70200-NM$195
Canine LC3B / MAP1LC3B clonagem de ADN ou de clonagem do gene (vector de clonagem), N-HA EtiquetaDG70200-NY$195
Canine LC3B / MAP1LC3B clonagem de ADN ou de clonagem do gene (vector de expressão)DG70200-U$75
Canine LC3B / MAP1LC3B clonagem de ADN ou de clonagem do gene (vector de clonagem)DG70200-UT$195
 Saiba mais sobre vectores de expressão
Product nameProduct name
Fundo

LC3B, also known as MAP1LC3B, is a member of the MAP1 LC3 family. It is moat abundantly expressed in heart, brain, skeletal muscle and testis. LC3B is a subunit of neuronal microtubule and functions in formation of autophagosomal vacuoles (autophagosomes). It associated MAP1A and MAP1B proteins, which are involved in microtubule assembly and important for neurogenesis. LC3B also plays a role in autophagy, a process that involves the bulk degradation of cytoplasmic component.

Referências
  • Behrends C. et al., 2010, Nature. 466 (7302): 68-76.
  • Tanida I. et al., 2005, Int J Biochem Cell Biol. 36 (12): 2503-18.
  • Kabeya Y. et al., 2000, EMBO J. 19 (21): 5720-8.
  • Cherra SJ. et al., 2010, J Cell Biol. 190 (4): 533-9.
  • Size / Price
    Catálogo: DG70200-CH
    Preço de catálogo: 
    Preço:      (You Save: )
    Tamanho:
    Quantidade:+-
    Disponibilidade2-3 weeks
    Bulk Discount RequiryAcrescentar a carrinho
    Contact Us
    Imagens
        Itens recentemente visualizados
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          Tenha em atenção o seguinte: Todos os produtos destinam-se "A FINS EXCLUSIVOS DE INVESTIGAÇÃO E NÃO DEVEM SER UTILIZADOS PARA EFEITOS DE DIAGNÓSTICO OU TERAPÊUTICOS"