Encomenda rápida

Canine IL-8/Interleukin-8/CXCL8 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag Etiqueta

    Folha de dadosAnálisesProdutos relacionadosProtocolos
    Canino CXCL8 Informações sobre o produto de clone de cDNA
    Gene_bank_ref_id:NM_001003200.1
    Tamanho de cDNA:306bp
    Descrição de cDNA:Full length Clone DNA of Canis lupus familiaris interleukin 8 with C terminal Flag tag.
    Sinónimo de gene:IL8
    Espécie:Canine
    Vetor:pCMV3-C-FLAG
    Plasmid:
    Local de restrição:
    Sequência de etiqueta:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
    Descrição da sequência:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
    FLAG Tag Info

    FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

    A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

    The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

    Canine IL-8/Interleukin-8/CXCL8 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag Etiqueta on other vectors
    Product nameProduct name
    Fundo

    Interleukin 8 (IL-8), also known as CXCL8, which is a chemokine with a defining CXC amino acid motif that was initially characterized for its leukocyte chemotactic activity, is now known to possess tumorigenic and proangiogenic properties as well. This chemokine is secreted by a variety of cell types including monocyte/macrophages, T cells, neutrophils, fibroblasts, endothelial cells, and various tumor cell lines in response to inflammatory stimuli (IL1, TNF, LPS, etc). In human gliomas, IL-8 is expressed and secreted at high levels both in vitro and in vivo, and recent experiments suggest it is critical to glial tumor neovascularity and progression. Levels of IL-8 correlate with histologic grade in glial neoplasms, and the most malignant form, glioblastoma, shows the highest expression in pseudopalisading cells around necrosis, suggesting that hypoxia/anoxia may stimulate expression. Interleukin (IL)-8/CXCL8 is a potent neutrophil chemotactic factor. Accumulating evidence has demonstrated that various types of cells can produce a large amount of IL-8/CXCL8 in response to a wide variety of stimuli, including proinflammatory cytokines, microbes and their products, and environmental changes such as hypoxia, reperfusion, and hyperoxia. Numerous observations have established IL-8/CXCL8 as a key mediator in neutrophil-mediated acute inflammation due to its potent actions on neutrophils. However, several lines of evidence indicate that IL-8/CXCL8 has a wide range of actions on various types of cells, including lymphocytes, monocytes, endothelial cells, and fibroblasts, besides neutrophils. The discovery of these biological functions suggests that IL-8/CXCL8 has crucial roles in various pathological conditions such as chronic inflammation and cancer. IL-8 has been associated with tumor angiogenesis, metastasis, and poor prognosis in breast cancer. IL-8 may present a novel therapeutic target for estrogen driven breast carcinogenesis and tumor progression.

    Referências
  • Mukaida N. (2003) Pathophysiological roles of interleukin-8/CXCL8 in pulmonary diseases. Am J Physiol Lung Cell Mol Physiol. 284(4): L566-77.
  • Brat DJ, et al. (2005) The role of interleukin-8 and its receptors in gliomagenesis and tumoral angiogenesis. Neuro Oncol. 7(2): 122-33.
  • Bendrik C, et al. (2009) Estradiol increases IL-8 secretion of normal human breast tissue and breast cancer in vivo. J Immunol. 182(1): 371-8.
  • Size / Price
    Catálogo: DG70009-CF
    Preço de catálogo: 
    Preço:      (You Save: )
    Tamanho:
    Quantidade:+-
    Disponibilidade
    Acrescentar a carrinhoBulk Discount Requiry

    Datasheet & Documentation

    Contact Us
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Tenha em atenção o seguinte: Todos os produtos destinam-se "A FINS EXCLUSIVOS DE INVESTIGAÇÃO E NÃO DEVEM SER UTILIZADOS PARA EFEITOS DE DIAGNÓSTICO OU TERAPÊUTICOS"