Encomenda rápida

Canine GATE-16 / GABARAPL2 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His Etiqueta

    Folha de dadosAnálisesProdutos relacionadosProtocolos
    Canino GABARAPL2 Informações sobre o produto de clone de cDNA
    Gene_bank_ref_id:XM_005620674.1
    Tamanho de cDNA:354bp
    Descrição de cDNA:Full length Clone DNA of Canis lupus familiaris GABA(A) receptor-associated protein-like 2 with C terminal His tag.
    Sinónimo de gene:GABARAPL2
    Espécie:Canine
    Vetor:pCMV3-C-His
    Plasmid:
    Local de restrição:
    Sequência de etiqueta:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
    Descrição da sequência:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
    His Tag Info

    A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

    Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

    Canine GATE-16 / GABARAPL2 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His Etiqueta on other vectors
    Canine GATE-16 / GABARAPL2 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-GFPSpark EtiquetaDG70191-ACG$225
    Canine GATE-16 / GABARAPL2 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-OFPSpark EtiquetaDG70191-ACR$225
    Canine GATE-16 / GABARAPL2 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-GFPSpark EtiquetaDG70191-ANG$225
    Canine GATE-16 / GABARAPL2 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-OFPSpark EtiquetaDG70191-ANR$225
    Canine GATE-16 / GABARAPL2 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag EtiquetaDG70191-CF$195
    Canine GATE-16 / GABARAPL2 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His EtiquetaDG70191-CH$195
    Canine GATE-16 / GABARAPL2 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Myc EtiquetaDG70191-CM$195
    Canine GATE-16 / GABARAPL2 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-HA EtiquetaDG70191-CY$195
    Canine GATE-16 / GABARAPL2 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Flag EtiquetaDG70191-NF$195
    Canine GATE-16 / GABARAPL2 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His EtiquetaDG70191-NH$195
    Canine GATE-16 / GABARAPL2 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Myc EtiquetaDG70191-NM$195
    Canine GATE-16 / GABARAPL2 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-HA EtiquetaDG70191-NY$195
    Canine GATE-16 / GABARAPL2 clonagem de ADN ou de clonagem do gene (vector de expressão)DG70191-U$75
    Canine GATE-16 / GABARAPL2 clonagem de ADN ou de clonagem do gene (vector de clonagem)DG70191-UT$195
     Saiba mais sobre vectores de expressão
    Product nameProduct name
    Fundo

    GATE-16, also known as ATG8, belongs to the MAP1 LC3 family. It is expressed at high levels in the brain, heart, prostate, ovary, spleen and skeletal muscle. GATE-16 is expressed at very low levels in lung, thymus and small intestine. GATE-16 is involved in intra-Golgi traffic. It modulates intra-Golgi transport through coupling between NSF activity and SNAREs activation. It first stimulates the ATPase activity of NSF which in turn stimulates the association with GOSR1.

    Referências
  • Ewing Rob M, et al. (2007) Large-scale mapping of human protein-protein interactions by mass spectrometry. Mol Syst Biol. 3(1):89.
  • Okazaki N, et al. (2000) Interaction of the Unc-51-like kinase and microtubule-associated protein light chain 3 related proteins in the brain: possible role of vesicular transport in axonal elongation. Brain Res Mol Brain Res. 85(1-2):1-12.
  • Xin Y, et al. (2001) Cloning, expression patterns, and chromosome localization of three human and two mouse homologues of GABA(A) receptor-associated protein. Genomics. 74 (3):408-13.
  • Size / Price
    Catálogo: DG70191-CH
    Preço de catálogo: 
    Preço:      (You Save: )
    Tamanho:
    Quantidade:+-
    Disponibilidade
    Acrescentar a carrinhoBulk Discount Requiry

    Datasheet & Documentation

    Contact Us
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Tenha em atenção o seguinte: Todos os produtos destinam-se "A FINS EXCLUSIVOS DE INVESTIGAÇÃO E NÃO DEVEM SER UTILIZADOS PARA EFEITOS DE DIAGNÓSTICO OU TERAPÊUTICOS"