After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Canine GATE-16 / GABARAPL2 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His Etiqueta

Folha de dadosAnálisesProdutos relacionadosProtocolos
Canine GABARAPL2 Informações sobre o produto de clone de cDNA
Gene_bank_ref_id:XM_005620674.1
Tamanho de cDNA:354bp
Descrição de cDNA:Full length Clone DNA of Canis lupus familiaris GABA(A) receptor-associated protein-like 2 with C terminal His tag.
Sinónimo de gene:GABARAPL2
Espécie:Canine
Vetor:pCMV3-C-His
Plasmid:
Local de restrição:
Sequência de etiqueta:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Descrição da sequência:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Canine GATE-16 / GABARAPL2 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His Etiqueta on other vectors
Canine GATE-16 / GABARAPL2 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-GFPSpark EtiquetaDG70191-ACG$225
Canine GATE-16 / GABARAPL2 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-OFPSpark EtiquetaDG70191-ACR$225
Canine GATE-16 / GABARAPL2 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-GFPSpark EtiquetaDG70191-ANG$225
Canine GATE-16 / GABARAPL2 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-OFPSpark EtiquetaDG70191-ANR$225
Canine GATE-16 / GABARAPL2 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag EtiquetaDG70191-CF$195
Canine GATE-16 / GABARAPL2 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His EtiquetaDG70191-CH$195
Canine GATE-16 / GABARAPL2 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Myc EtiquetaDG70191-CM$195
Canine GATE-16 / GABARAPL2 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-HA EtiquetaDG70191-CY$195
Canine GATE-16 / GABARAPL2 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Flag EtiquetaDG70191-NF$195
Canine GATE-16 / GABARAPL2 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His EtiquetaDG70191-NH$195
Canine GATE-16 / GABARAPL2 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Myc EtiquetaDG70191-NM$195
Canine GATE-16 / GABARAPL2 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-HA EtiquetaDG70191-NY$195
Canine GATE-16 / GABARAPL2 clonagem de ADN ou de clonagem do gene (vector de expressão)DG70191-U$75
Canine GATE-16 / GABARAPL2 clonagem de ADN ou de clonagem do gene (vector de clonagem)DG70191-UT$195
 Saiba mais sobre vectores de expressão
Product nameProduct name
Fundo

GATE-16, also known as ATG8, belongs to the MAP1 LC3 family. It is expressed at high levels in the brain, heart, prostate, ovary, spleen and skeletal muscle. GATE-16 is expressed at very low levels in lung, thymus and small intestine. GATE-16 is involved in intra-Golgi traffic. It modulates intra-Golgi transport through coupling between NSF activity and SNAREs activation. It first stimulates the ATPase activity of NSF which in turn stimulates the association with GOSR1.

Referências
  • Ewing Rob M, et al. (2007) Large-scale mapping of human protein-protein interactions by mass spectrometry. Mol Syst Biol. 3(1):89.
  • Okazaki N, et al. (2000) Interaction of the Unc-51-like kinase and microtubule-associated protein light chain 3 related proteins in the brain: possible role of vesicular transport in axonal elongation. Brain Res Mol Brain Res. 85(1-2):1-12.
  • Xin Y, et al. (2001) Cloning, expression patterns, and chromosome localization of three human and two mouse homologues of GABA(A) receptor-associated protein. Genomics. 74 (3):408-13.
  • Size / Price
    Catálogo: DG70191-CH
    Preço de catálogo: 
    Preço:      (You Save: )
    Tamanho:
    Quantidade:+-
    Disponibilidade2-3 weeks
    Bulk Discount RequiryAcrescentar a carrinho
    Contact Us
    Imagens
        Itens recentemente visualizados
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          Tenha em atenção o seguinte: Todos os produtos destinam-se "A FINS EXCLUSIVOS DE INVESTIGAÇÃO E NÃO DEVEM SER UTILIZADOS PARA EFEITOS DE DIAGNÓSTICO OU TERAPÊUTICOS"