Encomenda rápida

Canine GATE-16 / GABARAPL2 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His Etiqueta

Folha de dadosAnálisesProdutos relacionadosProtocolos
Canine GABARAPL2 Informações sobre o produto de clone de cDNA
Tamanho de cDNA:354bp
Descrição de cDNA:Full length Clone DNA of Canis lupus familiaris GABA(A) receptor-associated protein-like 2 with C terminal His tag.
Sinónimo de gene:GABARAPL2
Local de restrição:
Sequência de etiqueta:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Descrição da sequência:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Canine GATE-16 / GABARAPL2 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His Etiqueta on other vectors
Canine GATE-16 / GABARAPL2 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-GFPSpark EtiquetaDG70191-ACG$225
Canine GATE-16 / GABARAPL2 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-OFPSpark EtiquetaDG70191-ACR$225
Canine GATE-16 / GABARAPL2 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-GFPSpark EtiquetaDG70191-ANG$225
Canine GATE-16 / GABARAPL2 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-OFPSpark EtiquetaDG70191-ANR$225
Canine GATE-16 / GABARAPL2 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag EtiquetaDG70191-CF$195
Canine GATE-16 / GABARAPL2 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His EtiquetaDG70191-CH$195
Canine GATE-16 / GABARAPL2 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Myc EtiquetaDG70191-CM$195
Canine GATE-16 / GABARAPL2 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-HA EtiquetaDG70191-CY$195
Canine GATE-16 / GABARAPL2 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Flag EtiquetaDG70191-NF$195
Canine GATE-16 / GABARAPL2 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His EtiquetaDG70191-NH$195
Canine GATE-16 / GABARAPL2 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Myc EtiquetaDG70191-NM$195
Canine GATE-16 / GABARAPL2 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-HA EtiquetaDG70191-NY$195
Canine GATE-16 / GABARAPL2 clonagem de ADN ou de clonagem do gene (vector de expressão)DG70191-U$75
Canine GATE-16 / GABARAPL2 clonagem de ADN ou de clonagem do gene (vector de clonagem)DG70191-UT$195
 Saiba mais sobre vectores de expressão
Product nameProduct name

GATE-16, also known as ATG8, belongs to the MAP1 LC3 family. It is expressed at high levels in the brain, heart, prostate, ovary, spleen and skeletal muscle. GATE-16 is expressed at very low levels in lung, thymus and small intestine. GATE-16 is involved in intra-Golgi traffic. It modulates intra-Golgi transport through coupling between NSF activity and SNAREs activation. It first stimulates the ATPase activity of NSF which in turn stimulates the association with GOSR1.

  • Ewing Rob M, et al. (2007) Large-scale mapping of human protein-protein interactions by mass spectrometry. Mol Syst Biol. 3(1):89.
  • Okazaki N, et al. (2000) Interaction of the Unc-51-like kinase and microtubule-associated protein light chain 3 related proteins in the brain: possible role of vesicular transport in axonal elongation. Brain Res Mol Brain Res. 85(1-2):1-12.
  • Xin Y, et al. (2001) Cloning, expression patterns, and chromosome localization of three human and two mouse homologues of GABA(A) receptor-associated protein. Genomics. 74 (3):408-13.
  • Size / Price
    Catálogo: DG70191-CH
    Preço de catálogo: 
    Preço:      (You Save: )
    Disponibilidade2-3 weeks
    Bulk Discount RequiryAcrescentar a carrinho
    Contact Us
        Itens recentemente visualizados
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.