After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Encomenda rápida

Text Size:AAA

Canine C12H6orf57 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His Etiqueta

Folha de dadosAnálisesProdutos relacionadosProtocolos
Canine C12H6orf57 Informações sobre o produto de clone de cDNA
Tamanho de cDNA:324bp
Descrição de cDNA:Full length Clone DNA of Canis lupus familiaris chromosome 12 open reading frame, human C6orf57 with C terminal His tag.
Sinónimo de gene:C12H6orf57
Local de restrição:
Sequência de etiqueta:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Descrição da sequência:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Canine C12H6orf57 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His Etiqueta on other vectors
Canine C12H6orf57 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-GFPSpark EtiquetaDG70195-ACG$225
Canine C12H6orf57 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-OFPSpark EtiquetaDG70195-ACR$225
Canine C12H6orf57 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-GFPSpark EtiquetaDG70195-ANG$225
Canine C12H6orf57 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-OFPSpark EtiquetaDG70195-ANR$225
Canine C12H6orf57 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag EtiquetaDG70195-CF$195
Canine C12H6orf57 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His EtiquetaDG70195-CH$195
Canine C12H6orf57 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Myc EtiquetaDG70195-CM$195
Canine C12H6orf57 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-HA EtiquetaDG70195-CY$195
Canine C12H6orf57 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Flag EtiquetaDG70195-NF$195
Canine C12H6orf57 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His EtiquetaDG70195-NH$195
Canine C12H6orf57 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Myc EtiquetaDG70195-NM$195
Canine C12H6orf57 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-HA EtiquetaDG70195-NY$195
Canine C12H6orf57 clonagem de ADN ou de clonagem do gene (vector de expressão)DG70195-U$75
Canine C12H6orf57 clonagem de ADN ou de clonagem do gene (vector de clonagem)DG70195-UT$195
 Saiba mais sobre vectores de expressão
Product nameProduct name
Size / Price
Catálogo: DG70195-CH
Preço de catálogo: 
Preço:      (You Save: )
Disponibilidade2-3 weeks
Bulk Discount RequiryAcrescentar a carrinho
Contact Us
      Itens recentemente visualizados
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.