Encomenda rápida

Canine Aldolase C/ALDOC clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His Etiqueta

    Folha de dadosAnálisesProdutos relacionadosProtocolos
    Canino ALDOC Informações sobre o produto de clone de cDNA
    Gene_bank_ref_id:NM_001286945.1
    Tamanho de cDNA:1095bp
    Descrição de cDNA:Full length Clone DNA of Canis lupus familiaris aldolase C, fructose-bisphosphate with C terminal His tag.
    Sinónimo de gene:ALDOC
    Espécie:Canine
    Vetor:pCMV3-C-His
    Plasmid:
    Local de restrição:
    Sequência de etiqueta:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
    Descrição da sequência:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
    His Tag Info

    A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

    Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

    Canine Aldolase C/ALDOC clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His Etiqueta on other vectors
    Canine Aldolase C/ALDOC clonagem de ADN ou de clonagem do gene (vector de clonagem), C-GFPSpark EtiquetaDG70204-ACG$225
    Canine Aldolase C/ALDOC clonagem de ADN ou de clonagem do gene (vector de clonagem), C-OFPSpark EtiquetaDG70204-ACR$225
    Canine Aldolase C/ALDOC clonagem de ADN ou de clonagem do gene (vector de clonagem), N-GFPSpark EtiquetaDG70204-ANG$225
    Canine Aldolase C/ALDOC clonagem de ADN ou de clonagem do gene (vector de clonagem), N-OFPSpark EtiquetaDG70204-ANR$225
    Canine Aldolase C/ALDOC clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag EtiquetaDG70204-CF$195
    Canine Aldolase C/ALDOC clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His EtiquetaDG70204-CH$195
    Canine Aldolase C/ALDOC clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Myc EtiquetaDG70204-CM$195
    Canine Aldolase C/ALDOC clonagem de ADN ou de clonagem do gene (vector de clonagem), C-HA EtiquetaDG70204-CY$195
    Canine Aldolase C/ALDOC clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Flag EtiquetaDG70204-NF$195
    Canine Aldolase C/ALDOC clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His EtiquetaDG70204-NH$195
    Canine Aldolase C/ALDOC clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Myc EtiquetaDG70204-NM$195
    Canine Aldolase C/ALDOC clonagem de ADN ou de clonagem do gene (vector de clonagem), N-HA EtiquetaDG70204-NY$195
    Canine Aldolase C/ALDOC clonagem de ADN ou de clonagem do gene (vector de expressão)DG70204-U$75
    Canine Aldolase C/ALDOC clonagem de ADN ou de clonagem do gene (vector de clonagem)DG70204-UT$195
     Saiba mais sobre vectores de expressão
    Product nameProduct name
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Tenha em atenção o seguinte: Todos os produtos destinam-se "A FINS EXCLUSIVOS DE INVESTIGAÇÃO E NÃO DEVEM SER UTILIZADOS PARA EFEITOS DE DIAGNÓSTICO OU TERAPÊUTICOS"