After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Encomenda rápida

Text Size:AAA

Ratazanao CXCL5 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His Etiqueta

Folha de dadosAnálisesProdutos relacionadosProtocolos
Mouse CXCL5 Informações sobre o produto de clone de cDNA
Gene_bank_ref_id:NM_009141.2
Tamanho de cDNA:399bp
Descrição de cDNA:Full length Clone DNA of Mus musculus chemokine (C-X-C motif) ligand 5 with His tag.
Sinónimo de gene:LIX, GCP-2, Scyb5, Scyb6, ENA-78, AMCF-II, Cxcl5
Espécie:Mouse
Vetor:pCMV/hygro-His
Plasmid:pCMV-mCXCL5-10his
Local de restrição:KpnI + XhoI (5.5kb + 0.43kb)
Sequência de etiqueta:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Descrição da sequência:Identical with the Gene Bank Ref.ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
Mouse CXCL5 Gene Plasmid Map
Mouse CXCL5 Gene cDNA Clone (full-length ORF Clone), expression ready, His-tagged
pCMV/hygro-HIs Vector Information
 
Vector Name pCMV/hygro-His
Vector Size 5687bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag His
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)

Schematic of pCMV/hygro-His Multiple Cloning Sites

His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Product nameProduct name
Fundo

CXCL5 is a small cytokine belonging to the CXC chemokine family. CXC chemokines are particularly significant for leukocyte infiltration in inflammatory diseases. CXCL5 is produced following stimulation of cells with the inflammatory cytokines interleukin-1 or tumor necrosis factor-alpha. It also can be detected in eosinophils, and can be inhibited with the type II interferon. CXCL5 plays a role in reducing sensitivity to sunburn pain in some subjects, and is a potential target which can be utilized to understand more about pain in other inflammatory conditions like arthritis and cystitis. It stimulates the chemotaxis of neutrophils possesses angiogenic properties. It elicits these effects by interacting with the cell surface chemokine receptor CXCR2.

Referências
  • Dawes JM, et al. (2011) CXCL5 Mediates UVB Irradiation-Induced Pain. Sci Transl Med. 3(90): 90ra60.
  • O'Donovan N, et al. (1999) Physical mapping of the CXC chemokine locus on human chromosome 4. Cytogenet. Cell Genet. 84(1-2):39-42.
  • Persson T, et al. (2003) Expression of the neutrophil-activating CXC chemokine ENA-78/CXCL5 by human eosinophils. Clin Exp Allergy. 33(4):531-7.
  • Size / Price
    Catálogo: MG50354-M-H
    Preço de catálogo: 
    Preço:      (You Save: )
    Tamanho:
    Quantidade:+-
    DisponibilidadeIn Stock
    Bulk Discount RequiryAcrescentar a carrinho
    Contact Us
    Imagens
    • Mouse CXCL5 Gene cDNA Clone (full-length ORF Clone), expression ready, His-tagged
      Itens recentemente visualizados
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Tenha em atenção o seguinte: Todos os produtos destinam-se "A FINS EXCLUSIVOS DE INVESTIGAÇÃO E NÃO DEVEM SER UTILIZADOS PARA EFEITOS DE DIAGNÓSTICO OU TERAPÊUTICOS"