Encomenda rápida

Text Size:AAA

Humano CALML3 clonagem de ADN ou de clonagem do gene (vector de clonagem)

Folha de dadosAnálisesProdutos relacionadosProtocolos
Human CALML3 Informações sobre o produto de clone de cDNA
Tamanho de cDNA:
Descrição de cDNA:
Sinónimo de gene:
Local de restrição:
Sequência de etiqueta:
Descrição da sequência:Identical with the Gene Bank Ref. ID sequence.
Human CALML3 Gene Plasmid Map
Human CALML3 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
pCMV/hygro Vector Information
Vector Name pCMV/hygro
Vector Size 5657bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

Schematic of pCMV/hygro Multiple Cloning Sites
Product nameProduct name

Calmodulin-like protein 3 (CALML3) is similar to that of authentic calmodulin and may actually compete with calmodulin by binding, with different affinity, to cellular substrates. Calmodulin-like protein 3 (CALML3) is a tumor-sensitive protein specifically expressed in normal epithelial cells but downregulated in tumorigenesis. Downregulation of the protein is an early event in breast cancer development. One of the most pressing questions raised by the discovery of CLP/CALML3 is that of its potential targets. Although it is 85% identical to human calmodulin, the distinct properties of CLP suggest that it has specific targets or targets that only partially overlap with those of calmodulin. Research has identified the unconventional myosin-10 (Myo10) as a specific target of CALML3. The discovery of Myo10 as a specific target of CALML3 is highly significant and suggests multiple lines of further research such as investigations of the Ca2+ regulation of Myo10 and the role of the loss of CLP in epithelial differentiation, adhesion, and cancer. Cells expressing CALML3 displayed a striking increase in the number and length of myosin-10-positive filopodia and showed increased mobility in a wound healing assay.

  • Bennett RD, et al. (2007) Calmodulin-like protein increases filopodia-dependent cell motility via up-regulation of myosin-10. J Biol Chem. 282(5): 3205-12.
  • Perochon A, et al. (2011) Calmodulin and calmodulin-like proteins in plant calcium signaling. Biochimie. 93(12): 2048-53.
  • Chinpongpanich A, et al. (2011) Biophysical characterization of calmodulin and calmodulin-like proteins from rice, Oryza sativa L. Acta Biochim Biophys Sin (Shanghai). 43(11): 867-76.
  • Contact Us
    • Human CALML3 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.