Encomenda rápida

Humano ACVR2B/Activin RIIB clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag Etiqueta

Folha de dadosAnálisesProdutos relacionadosProtocolos
Human ACVR2B Informações sobre o produto de clone de cDNA
Tamanho de cDNA:1539bp
Descrição de cDNA:Full length Clone DNA of Homo sapiens activin A receptor, type I IB with Flag tag.
Sinónimo de gene:ACTRIIB, ActR-IIB, MGC116908
Local de restrição:KpnI + XbaI (5.4kb + 1.59kb)
Sequência de etiqueta:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Descrição da sequência:Identical with the Gene Bank Ref. ID sequence except for two point mutations: 333 A/G and 1458 C/T, neither of which results in the amino acid substitution.
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
pCMV2-FLAG Vector Information
Vector Name pCMV2-FLAG
Vector Size 5592bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag FLAG
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

Schematic of pCMV2-FLAG Multiple Cloning Sites

FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Product nameProduct name

ACVR2A and ACVR2B are two activin type II receptors. ACVR2B is integral to the activin and myostatin signaling pathway. Ligands such as activin and myostatin bind to ACVR2A and ACVR2B. Myostatin, a negative regulator of skeletal muscle growth, is regarded as a potential therapeutic target and binds to ACVR2B effectively, and to a lesser extent, to ACVR2A. The structure of human ACVR2B kinase domain in complex with adenine establishes the conserved bilobal architecture consistent with all other catalytic kinase domains. Haplotype structure at the ACVR2B and follistatin loci may contribute to interindividual variation in skeletal muscle mass and strength. Defects in ACVR2B are a cause of left-right axis malformations.

  1. Kosaki R, et al. (1999) Left-right axis malformations associated with mutations in ACVR2B, the gene for human activin receptor type IIB. Am J Med Genet. 82(1):70-6.
  2. Dupont S, et al. (2001) No evidence for linkage or for diabetes-associated mutations in the activin type 2B receptor gene (ACVR2B) in French patients with mature-onset diabetes of the young or type 2 diabetes. Diabetes 50(5):1219-21.
  3. Albertson RC, et al. (2005) Zebrafish acvr2a and acvr2b exhibit distinct roles in craniofacial development. Developmental dynamics 233(4): 1405-18.
  4. Walsh S, et al. (2007) Activin-type II receptor B (ACVR2B) and follistatin haplotype associations with muscle mass and strength in humans. J Appl Physiol. 102(6):2142-8.
Contact Us
      Itens recentemente visualizados
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.